blastn

compares a nucleotide query sequence against a nucleotide sequence database.

blastp

compares an amino acid query sequence against a protein sequence database.

blastx

compares a nucleotide query sequence translated in all reading frames against a protein sequence database.

tblastn

compares a protein query sequence against a nucleotide sequence database dynamically translated in all reading frames.

tblastx

compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.

EG5 linked [E. guineensis genome]

The file contains 16 EG5 chromosome (genetic scaffold) and 40,056 P5 scaffold sequences. The EG5 chromosomes resulted from a comparison of the P5-build to T128 and P2 genetic maps. The remaining P5 scaffolds that were not incorporated into the EG5 chromosomes were also included.

O8 scaffolds [E. oleifera genome]

The file contains a scaffold sequences from the E. oleifera O8-build.

P5 scaffolds [E. guineensis genome]

The file contains of scaffold sequences from the pisifera P5-build.

E. guineensis transcriptome.fna

Thirty transcriptome libraries were constructed and sequenced using Roche 454, of which 22 were from E. guineensis and 8 from E. oleifera. The E. guineensis and E. oleifera libraries were assembled independently using Newbler.

E. oleifera transcriptome.fna

Thirty transcriptome libraries were constructed and sequenced using Roche 454, of which 22 were from E. guineensis and 8 from E. oleifera. The E. guineensis and E. oleifera libraries were assembled independently using Newbler.

E. guineensis Genes.fna

A predicted nucleotide sequences (Version 2) of pisifera P5-build that had similarity to known proteins in RefSeq.

E. guineensis Genes.faa

A predicted amino acid sequences (Version 2) of pisifera p5-build that had similarity to known genes in RefSeq.

BAC.fna

Genomic DNA from Dura palms were used to create the BACs. The BAC clones were pooled into 4 pools (BAC9, BAC10, BAC11 & BAC12)and sequenced using 454. Each BAC pool was assembled separately and manually finished.

E. guineensis GT.faa

This is a contig and singlets of assembled reads from E. guineensis genomic libraries

E. oleifera GT.faa

This is a contig and singlets of assembled reads from E. oleifera genomic libraries.

Predicted Protein.faa [GT]

This is a nucleotide sequences of the predicted genes from the E. guineensis and E. oleifera contigs.

Predicted Transcript.fna [GT]

This is an amino acid sequences of the predicted genes from the E. guineensis and E. oleifera contigs

A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from the sequence data by a greater-than (">") symbol in the first column. An example sequence in FASTA format is:

>Sequence 
GGAGGGGGAAGCGGGTGCGGGAGACTAAATATATATTATATTTTTATAAGTTTGGTCTCTTCTCTCGCTCTCCACCCTCTCTGTGATTTACGCGGCCATTTTTTTTCTCAGCGATATCAATAAAGAGGCGGTAATCAACTAAAGGCGATGGGCGCGGGCGGACGAATGACGGCGAAAGAGCGGGAGGACCAGTCGGCGACGGCCCACGGCCCCGACGAGGACCCCTCCCTCCGGCGGTCGCCGACGGAGAAACCCCCATTCACATTGAGCCAGATCAAGAAGGCCATCCCCCCGCACTGCTTCCAGCGGTCCGTCCTCCGCTCCTTCTCCTACGTCGTCCACGACCTCGTCATCTCCGCCGCCCTCTTCTACGTCGCCCTCGCCGTCATCCCGACCCTCTCCCCGCCGCTCCTCCGCCTCGCCGCCTGGCCTCTCTACTGGGCCGCCCAGGGCTGCATCTTCACCGGCGTCTGGGTCATCGCCCACGAGTGCGGCCACCACGCCTTCTCCGACTCCTCCCTCCTCGACGACCTCGTCGGCCTCGTCCTCCACTCCGCCCTCCTCGTCCCCTACTTCTCCTGGAAGATCAGTCACCGCCGCCACCACTCCAACACCGGCTCGCTCGACCGCGACGAGGTCTTCGTCCCCAAGCGCAAGTCCGCCCTCCCTTGGTACTCCAGGTACATCAACAACCCCCCGGGCCGCGTCCTCACCTTGGCGGTGACCCTGATCCTCGGGTGGCCCCTGTACCTCGCCTTCAACGTCTCCGGCCGTCCGTATCCCCGGTTCGCCTGCCACTACGACCCCTACGGCCCGATCTACTCGGACCGGGAGCGGGCCCAGATCTTCATCTCCGACGCGGGCGTTCTCGCGGCGTTCTACGCGCTGTGCCGGATCGC

For those programs that use amino acid query sequences (BLASTP and TBLASTN), the accepted amino acid codes are: